FROM FASTQ TO READ MAPS IN dm3: ChIPseq (treatment and control) 2 ChIPseq experiments: (treatment) H3K4me3 and Control (input) Number of processes (threads) SAM output Info about running time mapping Indexes (dm3) Only reads with 1 hit Input file Output file FASTQ input > bowtie -t -p 4 -m 1 -S -q $FLY/genome rawfiles/H3K4me3_EID.fq maps/H3K4me3_EID.sam Time loading forward index: 00:00:00 Time loading mirror index: 00:00:00 Seeded quality full-index search: 00:33:46 # reads processed: 50624300 # reads with at least one reported alignment: 26219230 (51.79%) # reads that failed to align: 21122867 (41.72%) # reads with alignments suppressed due to -m: 3282203 (6.48%) Reported 26219230 alignments to 1 output stream(s) Time searching: 00:33:46 Overall time: 00:33:46 > bowtie -t -p 4 -m 1 -S -q $FLY/genome rawfiles/Control_EID.fq maps/Control_EID.sam Time loading forward index: 00:00:00 Time loading mirror index: 00:00:00 # reads processed: 25651696 # reads with at least one reported alignment: 15469848 (60.31%) # reads that failed to align: 6722832 (26.21%) # reads with alignments suppressed due to -m: 3459016 (13.48%) Reported 15469848 alignments to 1 output stream(s) Time searching: 00:17:44 Overall time: 00:17:44Ĥ. INDEXES FOR READ MAPPING WITH BOWTIE Drosophila_melanogaster/UCSC/dm3/Sequence/BowtieIndex/ genome.1.ebwt genome.2.ebwt genome.3.ebwt genome.4.ebwt genome.rev.1.ebwt genome.rev.2.ebwt Copy only those files into a single folder to export it: export FLY="/usr/local/molbio/indexes/dm3"ģ. RAW FORMAT: FASTQ Example: GGAGAAGTAGCCCGGAATGGTCGAGTAGGGAAGAGAAAGT a^Z]HY]]SZaV]a`VL\OOWNYT_\`BBBBBBBBBBBBB AAGGGCGCGAAGCCCGTTACCAAGCCCGCCAAGGGAACCG QYFQR_TXNUU]U]VGFFOOZTFZT_`]HNVJV\G_BB CGATACGTTCGCGTTCGTGTAACTTTGTGTTTGCAAATCA aa]a^aa_aa``^_aaaaaa_Z`baaa`a```aa^`^a^T ACTGCCCCACATCAGCACACCAAACACGTCCACCGCAGCT INMGNN]NZ\X_Z_ZN[XYBBBBBBBB …Ģ.
0 Comments
Leave a Reply. |
AuthorWrite something about yourself. No need to be fancy, just an overview. ArchivesCategories |